View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_low_71 (Length: 217)
Name: NF12611_low_71
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 23578345 - 23578533
Alignment:
| Q |
17 |
ctgtacctatgatgatcagcatatctgtccctatcttccctgtatctgtcccgctcacgatctcgatcccccctttcgcgctcacgatctcgagactttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23578345 |
ctgtacctatgatgatcagcatatctgtccctatcttccctgtatctgtcccgctcacgatctcgatcccccctttcgcgctcgcgatctcgagactttt |
23578444 |
T |
|
| Q |
117 |
cccgaccacggtcacggtcacgagatcgttcacgaaccacctctctatcatcacggtgctttctttctggccattcaggatgatgtcca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23578445 |
cccgaccacggtcacggtcacgagatcgttcacgaaccacctctctatcatcacggtgctttctttctggccattcaggatcatgtcca |
23578533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 23588603 - 23588791
Alignment:
| Q |
17 |
ctgtacctatgatgatcagcatatctgtccctatcttccctgtatctgtcccgctcacgatctcgatcccccctttcgcgctcacgatctcgagactttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23588603 |
ctgtacctatgatgatcagcatatctgtccctatcttccctgtatctgtcccgctcacgatctcgatcccccctttcgcgctcgcgatctcgagactttt |
23588702 |
T |
|
| Q |
117 |
cccgaccacggtcacggtcacgagatcgttcacgaaccacctctctatcatcacggtgctttctttctggccattcaggatgatgtcca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23588703 |
cccgaccacggtcacggtcacgagatcgttcacgaaccacctctctatcatcacggtgctttctttctggccattcaggatcatgtcca |
23588791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University