View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12611_low_75 (Length: 207)
Name: NF12611_low_75
Description: NF12611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12611_low_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 14 - 190
Target Start/End: Original strand, 23962266 - 23962442
Alignment:
| Q |
14 |
cagagaatatgggttgcttaattttcgtagatgtagatcaaataagaaaaatacataaaagtttataagctacaagagaaacatgaaacatgttcattga |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |||||||| |||| ||||||| |||||||| |
|
|
| T |
23962266 |
cagagaatatgggttgcttaattttcctagatgtagatcaaataagaaaaacacataaaagtttataaggtacaagagcaacaagaaacatattcattga |
23962365 |
T |
 |
| Q |
114 |
actaacaaccctacctaggaattggaccacatatatctgattcattgatttcaatctgtatagagcccttgactgat |
190 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23962366 |
actaacaaccctacctaggaatcggaccacatatatctgattcattgatttcaatctgtatagagcccttgactgat |
23962442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 117 - 190
Target Start/End: Complemental strand, 24001800 - 24001727
Alignment:
| Q |
117 |
aacaaccctacctaggaattggaccacatatatctgattcattgatttcaatctgtatagagcccttgactgat |
190 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24001800 |
aacaaccctacctaggatttggaccacatatatctgattcattgatttcaatctgcatagagcccttgactgat |
24001727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University