View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12612_high_11 (Length: 267)
Name: NF12612_high_11
Description: NF12612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12612_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 253
Target Start/End: Original strand, 31640712 - 31640954
Alignment:
| Q |
11 |
catagggactatctctcaaatctatcagctgctataaggtattaattattattgcaaattcataagtccttgaattcttgaatctagattatataactat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31640712 |
catagggactatctctcaaatctatcagctgctataaggtattaattattattgcaaattcataagtccttgaattcttgaaactagattatataactat |
31640811 |
T |
|
| Q |
111 |
ataagattaatatattggtaactccctggatcctaagataatatgaactcaatgcagggaagatggttgcaatgtgaggggttactttgtgtggtcatta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31640812 |
ataagattaatatattggtaactccctggatcctaagataatatgaactcaatgcagggaagatggttgcgatgtgaggggttactttgtgtggtcatta |
31640911 |
T |
|
| Q |
211 |
cttgataactgggagtggaacatgggatatacagtacgctttg |
253 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31640912 |
cttgataattgggagtggaacatgggatatacagtacgctttg |
31640954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University