View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12612_high_12 (Length: 255)
Name: NF12612_high_12
Description: NF12612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12612_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 238
Target Start/End: Complemental strand, 39746621 - 39746397
Alignment:
| Q |
14 |
aaaggtggctaaggttgcagaaagcgatgagttcatgaaacttgattaatataaggatctaaggaggcacaacagtaaggcggcgatggtggttgaacag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39746621 |
aaaggtggctaaggttgcagaaagcgatgagttcatgaaacttgattaatataaggatctagggaggcacaacagtaaggcggcgatggtggttgaacag |
39746522 |
T |
 |
| Q |
114 |
cttgaagcagaaaaaccggctaataccgaaaaagaagctgagagatgcagaggcagatgttgctatgttttcggcagcgatcaatggaaagatcactgag |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
39746521 |
cttgaagcagaaaaaccggctaatacggaaaaagaagctgagagatgcagaggcagctgttgctatgttttcggcagcgatcaatggaaagatcgctcag |
39746422 |
T |
 |
| Q |
214 |
agattgatgtctacggacaacaact |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39746421 |
agattgatgtctacggacaacaact |
39746397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 39763507 - 39763445
Alignment:
| Q |
174 |
tgctatgttttcggcagcgatcaatggaaagatcactgagagattgatgtctacggacaacaa |
236 |
Q |
| |
|
|||||||||||| |||| || ||| ||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
39763507 |
tgctatgttttcagcagggaacaacggaaagatcgctgagagatcgatgtctatggacaacaa |
39763445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University