View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12612_high_16 (Length: 211)
Name: NF12612_high_16
Description: NF12612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12612_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 93 - 152
Target Start/End: Original strand, 9604989 - 9605048
Alignment:
| Q |
93 |
gaagatgaaatgaagcgaagagagaacctgttgttagaagacgcgttgggaagcggttac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9604989 |
gaagatgaaatgaagcgaagagagaacctgttgttagaagacgcgttgggaagcggttac |
9605048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University