View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12612_high_16 (Length: 211)

Name: NF12612_high_16
Description: NF12612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12612_high_16
NF12612_high_16
[»] chr6 (1 HSPs)
chr6 (93-152)||(9604989-9605048)


Alignment Details
Target: chr6 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 93 - 152
Target Start/End: Original strand, 9604989 - 9605048
Alignment:
93 gaagatgaaatgaagcgaagagagaacctgttgttagaagacgcgttgggaagcggttac 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9604989 gaagatgaaatgaagcgaagagagaacctgttgttagaagacgcgttgggaagcggttac 9605048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University