View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12612_low_11 (Length: 289)
Name: NF12612_low_11
Description: NF12612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12612_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 15 - 272
Target Start/End: Complemental strand, 4998822 - 4998565
Alignment:
| Q |
15 |
attgccacaacagaaaaccgtctttgttttgaacaaggatttaaggttttcataacattgctacataaacctggatttcccattagacctgacaaataaa |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4998822 |
attgccacaacagaaaaccgtctgtgttttgaacaaggatttaaggttttcataacattgctacataaacctggatttcccattagacctgacaaataaa |
4998723 |
T |
|
| Q |
115 |
cttcgtggttaaaaccagaaggaacctcaccggataatttgttatcagaaacattgaactgattcaactttaagtttgctaactccaccggaatcttccc |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4998722 |
cttcgtggttaaaaccggaaggaacctcaccggataatttgttatcagaaacatcgaactgattcaactttaagtttgttaactccaccggaatcttccc |
4998623 |
T |
|
| Q |
215 |
cgttaaagaattaacggagagatcgaggtaaattaagtcaggtaatttaccaagttcc |
272 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4998622 |
cgttaaagaattaacggagagatcaaggtaaattaagtcaggtaatttaccaagttcc |
4998565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University