View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12612_low_19 (Length: 205)
Name: NF12612_low_19
Description: NF12612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12612_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 22 - 185
Target Start/End: Complemental strand, 38423620 - 38423459
Alignment:
| Q |
22 |
caaataacctattagttaaaaattcatctttttaaagatgaattctagcttcttttgtgaaccgtacgcatcttgatcaatacacaacacttattagcan |
121 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||| |
|
|
| T |
38423620 |
caaataatctattagttaaaaattcatctttttaaagatgaattctagcttcttttgtgaaccata--catcttgatcaatacacaacaattattagcat |
38423523 |
T |
|
| Q |
122 |
nnnnnngaatttatagaaaactagaacgaaggggtcttacttaccagacacgagtagatactga |
185 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38423522 |
ttttttgaatttatagaaaactagaaggaaggggtcttacttaccagacacgagtagatactga |
38423459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University