View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12614_high_10 (Length: 242)
Name: NF12614_high_10
Description: NF12614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12614_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 28067225 - 28066995
Alignment:
| Q |
1 |
caatatttggtttgatgtatttcatgttgtcatatgttcatgattttgtatatcattgtcttaattacagccaaagctccaatctctaaatgcacaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28067225 |
caatatttggtttgatgtatttcatgttgtcatatgttcatgattttgtatatcattgtcttaattacagccaaagctccaatctctaaatgcacaactt |
28067126 |
T |
|
| Q |
101 |
acttttgcaggcgtggagtcatttcaaagaagacttttggattcactgtcaatttgtcattgttaataatcaaagatggctttacatgaacattcagatg |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28067125 |
acttttgcaggcgtggaatcatttcaaagaagacttttggattcactgtcaatttgtcattgttaataatcaaagatggctttacatgaacattcagatg |
28067026 |
T |
|
| Q |
201 |
ttgttcagtggggtatgaatctttttgatgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28067025 |
ttgttcagtggggtatgaatctttttgatgt |
28066995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University