View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12614_high_11 (Length: 236)
Name: NF12614_high_11
Description: NF12614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12614_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 32087662 - 32087443
Alignment:
| Q |
1 |
tatagactatat-acaatttggaactttatacaatttggttaaaaagacaatagagttgttgttgtacttctttgagaaataattttgactctatttgac |
99 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32087662 |
tatagactatattacaatttggaactttatacaatttggttaaaaagacaatagagttgttgttgtacttctttcagaaataattttgactctatttgac |
32087563 |
T |
|
| Q |
100 |
aagtgtcatctactatttagaggtgatttgtctttcatattttatactggatataggataatatatgattagacttgttttgggaatgatgttaaatgaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32087562 |
aagtgtcatctactatttagaggtgatttgtctttcatattttatactggatataggataagatatgattagacttgtttggggaatgatgttaaatgaa |
32087463 |
T |
|
| Q |
200 |
atgatttttacacatttgat |
219 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
32087462 |
attatttttacacatttgat |
32087443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University