View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12614_high_6 (Length: 384)
Name: NF12614_high_6
Description: NF12614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12614_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 39725282 - 39725109
Alignment:
| Q |
18 |
tgcatcataaaatctttgatttaattgtttaagaacgactgtactataaaaccgcattagaaaatctaatgattggattagaactttatagaaagatcta |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
39725282 |
tgcatcataaaagctttgatttaattgtttaagaacgactgtactataaaaccgcattagaaaatctagtggttggattagaactttgtagaaagatcta |
39725183 |
T |
 |
| Q |
118 |
actcacacaaagtcaaaacatggacgatcaaatacattgcgtgactaggtgcaatttatgttgcatgcttgtag |
191 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39725182 |
actcacacaaagtcaaaacatggccgatcaaatacattgcgtgactaggtgcaatttatgttgcatgcttgtag |
39725109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 266 - 350
Target Start/End: Complemental strand, 39725035 - 39724951
Alignment:
| Q |
266 |
gttataatattgtagtagtgcaggctcttcaatcaaaatttctttactttctagtgagaatgacgctgtaatcaaatttgttttc |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39725035 |
gttataatattgtagtagtgcaggctcttcaatcaaaatttctttactttctagtgagaatgacgctgtaatcaaatttgttttc |
39724951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University