View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12614_low_16 (Length: 206)
Name: NF12614_low_16
Description: NF12614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12614_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 10 - 191
Target Start/End: Original strand, 22709479 - 22709660
Alignment:
| Q |
10 |
agtgagatgaaaattgtccaacaacacaacacaccttcatcttctacttcgtagtttcacgttgacaacttttgaaacgctaatcctaaaagatttcaac |
109 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22709479 |
agtgagatgaaaattgcccaacaacacaatacaccttcatcttctacttcgtagtttcacgttgactacttttgaaacgctaatcctaaaagatttcaac |
22709578 |
T |
 |
| Q |
110 |
caaaatagctttcttcaaacatgattttgaaaaagtaactctgcaaacatgattcttaaaaattgattccaaacgcattttc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22709579 |
caaaatagctttcttcaaacatgattttgaaaaagtgactctgcaaacatgattcttaaaaattgattccaaacgcactttc |
22709660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University