View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12616_high_2 (Length: 362)
Name: NF12616_high_2
Description: NF12616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12616_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 352
Target Start/End: Complemental strand, 43366702 - 43366358
Alignment:
| Q |
1 |
acattccggtaatcaaacaatgtcctcaccttcnnnnnnnatgcattgtttgttatgttgctaatatcttccttttgtttcttcgaatttgaagacaagt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366702 |
acattccggtaatcaaacaatgttctcacctt---tttttattcattttttgttatgttgctaatatcttccttttgtttcttcgaatttgaagacaagt |
43366606 |
T |
 |
| Q |
101 |
gaaggtacttacaagcatgatctatggaattcgaggaactcgcagcttttctctgcctgcagtaatgccggtgtcaactttgcaagtaaacttcatccta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366605 |
gaaggtacttacaagcatgatctatggaattcgaggaactcgcagcttttctctgcctgcagttatgccggtgtcaactttgcaagtaaacttcatccta |
43366506 |
T |
 |
| Q |
201 |
gactcctagctagtccttttttcatctcatcaatttaattttgattgagtgtatttatttatatttctaattgttgcagaggctaatagcaaaactcatc |
300 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366505 |
gactc----ctagtccttttttcatctcatcaatttaattttgattgagtgtatttatttatatttctaattgttgcagaggctaatagcaaaactcatc |
43366410 |
T |
 |
| Q |
301 |
cggaccgatacttgttaatcgcaaccagtggaggcttaaatcaacagtgaac |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43366409 |
cggaccgatacttgttaatcgcaaccagtggaggcttaaatcaacagagaac |
43366358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University