View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12617_high_2 (Length: 462)
Name: NF12617_high_2
Description: NF12617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12617_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 137 - 459
Target Start/End: Complemental strand, 19913567 - 19913245
Alignment:
| Q |
137 |
tacctagaaaaggcttgctatccatttcagacaatgatgaagaacttccaccttgtgaatctactgaaccttgagaagatggttgtgtaaacaatccttg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19913567 |
tacctagaaaaggcttgctatccatttcagacaatgatgaagaacttccaccttgtgaatctactgaaccttgcgaagatggttgtgtaaacaatccttg |
19913468 |
T |
 |
| Q |
237 |
aaaaccaaccccaattttcccttttcctaaaacatcaccaagaacaacttgctttgttgttgcattagcccaattaaaaggtggtggtgcagcaccaacc |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913467 |
aaaaccaaccccaattttcccttttcctaaaacatcaccaagaacaacttgctttgttgttgcattagcccaattaaaaggtggtggtgcagcaccaacc |
19913368 |
T |
 |
| Q |
337 |
gctgacctagtcaaccccattgttacacctgaaccctcaatttcctccgaaccaccaccaccggtagctcctgcggcggtggaggtggaatctttctccg |
436 |
Q |
| |
|
| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19913367 |
gttgacctattcaaccccattgttacacctgaaccttcaatttcctccgaaccaccaccaccggtagctcctgcggcggtggaggtggaatctttgtccg |
19913268 |
T |
 |
| Q |
437 |
acttggaaactctctgcttctcc |
459 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
19913267 |
acttggaaactctctgcttctcc |
19913245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 21 - 54
Target Start/End: Complemental strand, 19913691 - 19913658
Alignment:
| Q |
21 |
catacatataaggaaactactaatcaacaatcat |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19913691 |
catacatataaggaaactactaatcaacaatcat |
19913658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University