View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12617_high_7 (Length: 296)
Name: NF12617_high_7
Description: NF12617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12617_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 24884860 - 24884577
Alignment:
| Q |
1 |
gaaattgacaaaagagtaagttgattgtttaccttgtttctcttcaacaaactcagtgaaaggtgtgcttgacatgttcattgtgcacatcttaaaatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24884860 |
gaaattgacaaaagagtaagttgattgtttaccttgtttctcttcaacaaactcagtgaaaggtgtgcttgacatgttcattgtgcacatcttaaaatgt |
24884761 |
T |
|
| Q |
101 |
atgcagttcactacaatgataagtaaaacccgactggaccttgagagtgaactttccaacatgcgcattttggacaataatccccagaagccagttgttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24884760 |
atgcagttcactacaatgataagtaaaacccgactggaccttgagagtgaactttccaacatgcgcattttggacaataatccccagaagccagttgttc |
24884661 |
T |
|
| Q |
201 |
ggatggcaaatttgtgtgtggtttctgctcatactgtaagtgatgcacttatttaaatctcatccatcttaccctattgatgtc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24884660 |
ggatggcaaatttgtgtgtggtttctgctcatactgtaagtgatgcgcttatttaaatctcatccatcttaccctattgatgtc |
24884577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University