View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12617_high_9 (Length: 262)
Name: NF12617_high_9
Description: NF12617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12617_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 30 - 242
Target Start/End: Original strand, 27625217 - 27625429
Alignment:
| Q |
30 |
gacatcagaaagagtttggttgatcccatgaacaaactgaggaactggaataagggtgacccatgtgcaacaaactggactggagtttggtgttttgata |
129 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27625217 |
gacatcaaaaagagtttggttgatcccatgaacaaactgaggaactggaataagggtgacccatgtgcaacaaactggactggagtttggtgttttgata |
27625316 |
T |
 |
| Q |
130 |
agaagggcaatgatggttacttccatatccgcgagctgtatgtcttttttgtccttctgttttctttttgcttgtgtttcagttcaataatcaattccac |
229 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
27625317 |
agaagggcgatgatggttacttccatatccgcgagctgtatgtcttttttgtccttctgttttctttttgctcgtgtttcagttcaataatcaattttac |
27625416 |
T |
 |
| Q |
230 |
atagatttctaaa |
242 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
27625417 |
ataggtttctaaa |
27625429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 30 - 199
Target Start/End: Original strand, 6856331 - 6856500
Alignment:
| Q |
30 |
gacatcagaaagagtttggttgatcccatgaacaaactgaggaactggaataagggtgacccatgtgcaacaaactggactggagtttggtgttttgata |
129 |
Q |
| |
|
||||||| |||||||||| ||||||| | |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| | ||||||||| |
|
|
| T |
6856331 |
gacatcaaaaagagtttgattgatccgagtgacaaactgaggaactggaataagggtgatccatgtgcagcaaactggactggagttcgttgttttgatt |
6856430 |
T |
 |
| Q |
130 |
agaagggcaatgatggttacttccatatccgcgagctgtatgtcttttttgtccttctgttttctttttg |
199 |
Q |
| |
|
||||| ||||||||||||||||||| || |||||||||| ||||||| || |||||||||| ||||| |
|
|
| T |
6856431 |
taaagggtgatgatggttacttccatattcgagagctgtatggcttttttatcattctgttttcgttttg |
6856500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University