View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12617_low_18 (Length: 255)
Name: NF12617_low_18
Description: NF12617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12617_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 20 - 244
Target Start/End: Complemental strand, 44695484 - 44695258
Alignment:
| Q |
20 |
aggacactttttctttgttttgatttcaccttttaaatacattgatctcaaatctttttggagtctttgaggaa--attaattaatgttttgtacggcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44695484 |
aggacactttttctttgttttgatttcaccttttaaatacattgatctcaaatctttttggagtctttgaggaattattaattaatgttttgtacggcag |
44695385 |
T |
|
| Q |
118 |
gaatggtgaaactttgcctcaaatatcaaaggaatacataagagtaaagtaagtggtgcaagttagcatgcatggctgatcgatccatcatatcaacatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44695384 |
gaatggtgaaactttgcctcaaatatcaaaggaatacataagagtaaagtaagtggtgcaagttagcatgcatggctgatcgatccatcatatcaacatt |
44695285 |
T |
|
| Q |
218 |
acatttttccattttgccatgatgatg |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44695284 |
acatttttccattttgccatgatgatg |
44695258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University