View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12617_low_21 (Length: 214)
Name: NF12617_low_21
Description: NF12617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12617_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 36999090 - 36998908
Alignment:
| Q |
17 |
atagtatacttttgaagaactcttttttcttctttcaatgtgctagttatgggtcacatttgtgttgtttgttcctaacatgtgttgaactaatttatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36999090 |
atagtatacttttgaagaactcttttttcttctttcaatgtgctagttatgggtcacatttgtgttgtttgttcctaacatgtgttgaactaatttatct |
36998991 |
T |
|
| Q |
117 |
ccagactgagaagatgacagcacgtgatcctgtgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998990 |
ccagactgagaagatgacagcacgtgatcctgtgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcag |
36998908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 36994182 - 36994121
Alignment:
| Q |
118 |
cagactgagaagatgacagcacgtgatcctgtgcaaaaagagatggcaacccataagaaaga |
179 |
Q |
| |
|
||||| ||||||||||| |||| ||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
36994182 |
cagacagagaagatgacggcacatgatcctttgcaaaaagagatggcaacccaaaagaaaga |
36994121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 36988407 - 36988346
Alignment:
| Q |
118 |
cagactgagaagatgacagcacgtgatcctgtgcaaaaagagatggcaacccataagaaaga |
179 |
Q |
| |
|
||||| ||||||||||| |||| ||||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
36988407 |
cagacagagaagatgacggcacatgatcctttgcaaaaggagatggcaacccaaaagaaaga |
36988346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University