View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12618_high_6 (Length: 298)
Name: NF12618_high_6
Description: NF12618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12618_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 39309601 - 39309339
Alignment:
| Q |
1 |
acacatcggcctccttcttctcatctagatccctcccgccggtgccgccgtctcgtctgtcattatccacccataaaacccttaatcaccatactagaca |
100 |
Q |
| |
|
||||| |||||||||||||||||||| || |||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39309601 |
acacaccggcctccttcttctcatctgaattcctctcgccggtgccgccgtctcctctgtcattatccatccataaaacccttaatcaccatactagaca |
39309502 |
T |
 |
| Q |
101 |
ggccaaaacctggaataatgattgcaaaaacccaaccttttacaaccacacaaaacccaccgaagttgactccgtcacgtgcgtctgtttagttcctccc |
200 |
Q |
| |
|
|||||||| |||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39309501 |
ggccaaaattaggaacaccgattgcaaaaacccaaccttttacaaccacacaaaacccatcgaagttgactccgtcacgtgcgtctgtttagttcctccc |
39309402 |
T |
 |
| Q |
201 |
attctcttcacttccttcgctgccgtcatcgccgcttaaatctccgttgtcctcctccatttc |
263 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39309401 |
gttctcttcacttcattcgctgtcgtcatcgccgcttaaatctcagttgtcctcctccatttc |
39309339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University