View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12618_low_9 (Length: 257)
Name: NF12618_low_9
Description: NF12618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12618_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 7871068 - 7871300
Alignment:
| Q |
1 |
tttaaattggataaactcacatgtataaccggagttgtaaaaaattgtatttggcatcgaaaatatttgctctttatttatgacattgtggcgacgaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
7871068 |
tttaaattggataaactcacatgtataaccggagttgtaaaa--ttgtatttggcatcgaaaatatttggtctttatttatgacattgtggcaacgaata |
7871165 |
T |
|
| Q |
101 |
atcgtcattatgannnnnnnnnaccaaatcattcgttttaatctgattaaacaaaaaacgaactaatttgattgaaggtgtttggagaaatgtcaggatg |
200 |
Q |
| |
|
||||| ||||||| | ||| | ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7871166 |
atcgttattatgatttttttt-atcaagttattcgatttaatctgattaaataaaaaacgaactaatttgattgaaggtgtttggagaaatgtcaggatg |
7871264 |
T |
|
| Q |
201 |
atctaatcacactctcaccccaaaacaacgttttaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7871265 |
atctaatcacactctcaccccaaaacaacgttttaa |
7871300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University