View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1261_high_14 (Length: 287)

Name: NF1261_high_14
Description: NF1261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1261_high_14
NF1261_high_14
[»] chr4 (1 HSPs)
chr4 (168-287)||(39825584-39825701)


Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 168 - 287
Target Start/End: Original strand, 39825584 - 39825701
Alignment:
168 tacctgtaatctgtaaattgtagtattggattttggtggcatgtgaagtagccggccacaaagttgtttgtatttgagagttgagattttgtcgtgtatt 267  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||  |||||||||||||||||||||||    
39825584 tacctgtaatctgtaaattgtagtattggattttggtggcatgtgaagtagccggccacaaaattgtttgtattt--gagttgagattttgtcgtgtatt 39825681  T
268 tggttcactctttcatctca 287  Q
    || |||||||||||||||||    
39825682 tgattcactctttcatctca 39825701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University