View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1261_high_19 (Length: 256)
Name: NF1261_high_19
Description: NF1261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1261_high_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 125 - 256
Target Start/End: Complemental strand, 47562992 - 47562861
Alignment:
| Q |
125 |
acattgtatccatttctttaaatcttgcataaatttacaatagggttcttatttggtaactcacaccatgaggcattataaaatcttgatcattatagag |
224 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| || |
|
|
| T |
47562992 |
acattgtatccatttctttaaattttgcataaatttacaatagggttcttatttggtaactcacaccacgaggcattacaaaatcttgatcattatatag |
47562893 |
T |
 |
| Q |
225 |
acatgtggaaatcgataaattattgtcaattt |
256 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |
|
|
| T |
47562892 |
acttgtggaaatcgataaattattgtcaattt |
47562861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 64
Target Start/End: Complemental strand, 49011367 - 49011307
Alignment:
| Q |
5 |
agtagctagaatatgtcacattttatgtgggatatatggattcg-ttcttctgtctgtggt |
64 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
49011367 |
agtagctagaatatgtcaaattttatgtgggatatatggcttcgtttcttctgtctgtggt |
49011307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 5 - 64
Target Start/End: Complemental strand, 38184014 - 38183955
Alignment:
| Q |
5 |
agtagctagaatatgtcacattttatgtgggatatatggattcgttcttctgtctgtggt |
64 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| | ||| |||||||||||||||| |
|
|
| T |
38184014 |
agtagctagaatgtgtcacattttatgtgggatatattgtttctttcttctgtctgtggt |
38183955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University