View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1261_low_15 (Length: 344)
Name: NF1261_low_15
Description: NF1261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1261_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 13 - 316
Target Start/End: Complemental strand, 30468354 - 30468050
Alignment:
| Q |
13 |
aatattacatgcttagattcactcgaaatctaacaccctctacaactacaacatcatactgcaactgcagatgatctaatatttgatcaaaaagtaacaa |
112 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30468354 |
aatattacatgcgtagattcattcgaaatctaacaccccctacaactgcaacatcatactgcaactgcagatgatctaatatttgatcaaaaagtaacaa |
30468255 |
T |
|
| Q |
113 |
cttatagcttcatatccaaaatcctt-cgaggttaaggaaaatttggtggtgaatcatggcccacaccaggactatgaccaggagtagttggacgaaaag |
211 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30468254 |
cttatagcttcatacccaaaatcctttcgaggttaaggaaaatttggtggcgaatcatggcccacaccaggactatgaccaggactagttggacgaaaag |
30468155 |
T |
|
| Q |
212 |
catcaccttgactatccttgtcatcatttttggtataaaaaccaatggaaggagcttgtggactcctcaacaaagctcttggaattgttggtggtgcttc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30468154 |
catcaccttgactatccttgtcatcatttttggtataaaagccaatggaaggagcttgtggactcctcaacaaaactcttggaattgttggtggtgcttc |
30468055 |
T |
|
| Q |
312 |
aacat |
316 |
Q |
| |
|
||||| |
|
|
| T |
30468054 |
aacat |
30468050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University