View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1261_low_18 (Length: 321)
Name: NF1261_low_18
Description: NF1261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1261_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 7e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 103 - 231
Target Start/End: Complemental strand, 6309603 - 6309475
Alignment:
| Q |
103 |
aaaggtaaatatagagaggtaacaagtgaaatggtaaaagtgaatgaagaaaatagtggtatatataggagtgaagtcctggaaagaggattatggtaaa |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
6309603 |
aaaggtaaatttagagaggtaacaagtgaaatagtaaaagtgaatgaagaaaatgatagtatatataggggtgaagttacggaaagaggactatggtaaa |
6309504 |
T |
 |
| Q |
203 |
caaataatatagtatgagtgatgtgataa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6309503 |
caaataatatagtatgagtgatgtgataa |
6309475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University