View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1261_low_22 (Length: 287)
Name: NF1261_low_22
Description: NF1261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1261_low_22 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 168 - 287
Target Start/End: Original strand, 39825584 - 39825701
Alignment:
| Q |
168 |
tacctgtaatctgtaaattgtagtattggattttggtggcatgtgaagtagccggccacaaagttgtttgtatttgagagttgagattttgtcgtgtatt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39825584 |
tacctgtaatctgtaaattgtagtattggattttggtggcatgtgaagtagccggccacaaaattgtttgtattt--gagttgagattttgtcgtgtatt |
39825681 |
T |
|
| Q |
268 |
tggttcactctttcatctca |
287 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
39825682 |
tgattcactctttcatctca |
39825701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University