View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1261_low_26 (Length: 275)
Name: NF1261_low_26
Description: NF1261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1261_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 29 - 236
Target Start/End: Complemental strand, 10614209 - 10613998
Alignment:
| Q |
29 |
aaaaactcatgtcgtacgtgactcatgatacaaaacgacaatatatagtatatctttggaaagttgttctccattctcgaaacaagtacagattttcatt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10614209 |
aaaaactcatgtcgtacgtgactcatgatacaaaacgacaatatatagtatatctttggaaagttgttctccattcttgaaacaagtacagattttcatt |
10614110 |
T |
|
| Q |
129 |
actagaaaaaacaaataaatggc----cagatcaattttccaaaattgttctgctggccaggttttggaataactattttaggataagttcacaaaaagc |
224 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10614109 |
actacaaaaaacaaataaatggccagacagatcaattttccaaaattgttctgctggccaggttttggaataactattttaggataagttcacaaaaagc |
10614010 |
T |
|
| Q |
225 |
tattgattgaga |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10614009 |
tattgattgaga |
10613998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University