View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1261_low_43 (Length: 201)
Name: NF1261_low_43
Description: NF1261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1261_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 62 - 182
Target Start/End: Original strand, 39825584 - 39825702
Alignment:
| Q |
62 |
tacctgtaatctgtaaattgtagtattggattttggtggcatgtgaagtagccggccacaaaattgtttgtatttgagagttgagattttgtcgtgtatt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39825584 |
tacctgtaatctgtaaattgtagtattggattttggtggcatgtgaagtagccggccacaaaattgtttgtattt--gagttgagattttgtcgtgtatt |
39825681 |
T |
 |
| Q |
162 |
tgattcactctttcatctcac |
182 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39825682 |
tgattcactctttcatctcac |
39825702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University