View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262-Insertion-4 (Length: 166)
Name: NF1262-Insertion-4
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262-Insertion-4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 7 - 166
Target Start/End: Original strand, 11764681 - 11764840
Alignment:
| Q |
7 |
aaaagtttcttttcttctgcatttttaaatacatcaaagttcacttgatttaacgacttgtttgaatcgatttatttaaatatctacttgcatacgagac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
11764681 |
aaaagtttcttttcttctgcatttttaaatacatcaaagttcacttgttttaacgacttgtttgaatcgacttatttaaatatctacttgcatatgagac |
11764780 |
T |
 |
| Q |
107 |
tatttgagagagtttatacggaaacaaagtatggtaggcccataagttgtttttagttta |
166 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11764781 |
tatttgagaaagtttatacggaaacaaagtatggtaggcccataagttgtttttagttta |
11764840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University