View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12620_low_11 (Length: 317)
Name: NF12620_low_11
Description: NF12620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12620_low_11 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 470 - 166
Alignment:
| Q |
1 |
tcaatgttcctaactagctgcatgaataaaacaggttgcttttatcataaccaatggtttccatttccctatactaattactaatacttgacaacaccgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
470 |
tcaatgttcctaactagctgcatgaataaaacagtttgcttttatcataaccaatggtttccatttccctatactaattactacttcttgacaacaccgt |
371 |
T |
 |
| Q |
101 |
ttggtttgtagtcattat---gtcaaagtagcttaatccaaactccaaaacttgtttctgtttccaccttttggtcactcaagatgaggtctgaaaatat |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
370 |
ttggtttgtagtcattattatgtcaaagtagcttaatccaaactccaaaacttgtttctgtttccaccttttggtcactcaagatgaggtctgaaaatat |
271 |
T |
 |
| Q |
198 |
gggatcattgttttcactgcaaaatcacaaccttttctgtgttaaatttgcagcatcatttttcttagttggtcttgcttttcgtcttctcttttgggat |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
270 |
gggatcattgttttcactgcaaaatcacaaccttttctgtgttaaatttgcagcatcatttttcttagttggtcttgcttttcgtcttctcttttgggat |
171 |
T |
 |
| Q |
298 |
tcttt |
302 |
Q |
| |
|
||||| |
|
|
| T |
170 |
tcttt |
166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University