View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12620_low_16 (Length: 256)
Name: NF12620_low_16
Description: NF12620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12620_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 76 - 252
Target Start/End: Original strand, 9987909 - 9988085
Alignment:
| Q |
76 |
aacttctcatctaatatgagcaaaaacaacatgattaaaatgagaactggtttgtttacattcatttacgagagagcccctaacaaggaagtttatcccg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9987909 |
aacttctcatctaatatgagcaaaaacaacatgattaaaatgagaactggttagtttacattcatttacgagagagcccttaacaaggaagtttatcccg |
9988008 |
T |
 |
| Q |
176 |
ctattttcctacaatattatcgaatttgaataatcgacttcactttatgtgtctatctcgtcattttcttctctctc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
9988009 |
ctattttcctacaatattatcgaatttgaataatcgacttcactttatgtgtttatctagtcattttcttctctctc |
9988085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 36 - 105
Target Start/End: Original strand, 9987842 - 9987911
Alignment:
| Q |
36 |
tatcaattgcaaacttagctaaataatgagccgtttgattaacttctcatctaatatgagcaaaaacaac |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9987842 |
tatcaattgcaaacttagctaaataatgagccgtttgattaacttctcatctaatctgagcaaaaacaac |
9987911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 41 - 95
Target Start/End: Complemental strand, 20782021 - 20781967
Alignment:
| Q |
41 |
attgcaaacttagctaaataatgagccgtttgattaacttctcatctaatatgag |
95 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| |||||| ||||| ||||| |
|
|
| T |
20782021 |
attgcaaacttagctaaataatgagcagcttgattagcttctcttctaacatgag |
20781967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University