View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12620_low_8 (Length: 343)
Name: NF12620_low_8
Description: NF12620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12620_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 340
Target Start/End: Original strand, 40943762 - 40944102
Alignment:
| Q |
1 |
gacaaagaaacggttatagggtcaaaggagaaaatctgaagcaaagcaggacaagaatttccacgcttggaccttccaagaacaactaggttgagatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40943762 |
gacaaagaaacggttatagggtcaaaggagaaaatctgaagcaaagcaggacaagaatttccacgcttggaccttccaagaacaactaggttgagatttt |
40943861 |
T |
|
| Q |
101 |
cgggtctccgaatccatgacccgcaagtaaccggaccctgaggtgacccagcatcattctccatccaaattctcagaaatttgaaatatggattcaaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40943862 |
cgggtctccgaatccatgacccgcaagtaaccggaccctgaggtgacccagcatcattctccatccaaattctcagaaatttgaaatatggattcaaagt |
40943961 |
T |
|
| Q |
201 |
ttgcttcttttttcaattgggtcactg-aaatcaagggnnnnnnnnatgaaaatcgttgattggaatttcgtctgtaaaatgcaatgttatatagaaata |
299 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40943962 |
ttgcttcttttttcaattgggtcactgaaaatcaagggttttttttatgaaaatcgttgattggaatttcgtctgtagaatgcaatgttatatagaaata |
40944061 |
T |
|
| Q |
300 |
tccgaagaggaaagagaggggcaatagcacaagttgttgtt |
340 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
40944062 |
tccgaagaggaaagagagggtcactagcacaagttgttgtt |
40944102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University