View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12621_high_14 (Length: 267)
Name: NF12621_high_14
Description: NF12621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12621_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 47127984 - 47127729
Alignment:
| Q |
1 |
tattgtgcaatgtaaaagtacaaaatacaagttatgtttaaatagtgagacagaactaaaataggtaaatattgtcttaattttcagnnnnnnnngtcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47127984 |
tattgtgcaatgtaaaagtacaaaatacaagttatgtttaaatagtgagacagaactaaaataggtaaatattgtcttaattttcagaaaaaaa-gtcga |
47127886 |
T |
|
| Q |
101 |
tatgatggaacctatactgtaatagtgattaagatttgaatcaaactaaaatatataggatgaatgagattgacaataccgtcaactgcgtcttgtgagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47127885 |
tatgatggaacctatactgtaatagtgattaagatttgaatcaaactaaaatatatagggtgaatgagattgacaataccgtcaactgcatcttgtgagg |
47127786 |
T |
|
| Q |
201 |
taggtgtcttagagttatgatcgatccaatactgcaatcgttcatcggctatctctg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47127785 |
taggtgtcttagagttatgatcgatccaatactgcaatcgctcatcggctatctctg |
47127729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University