View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12621_high_16 (Length: 259)
Name: NF12621_high_16
Description: NF12621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12621_high_16 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 259
Target Start/End: Original strand, 36059660 - 36059903
Alignment:
| Q |
16 |
acatttcatgtctatttgatgaattcttaattcgtgttatctaactagagagtgtgggagtcttgcgatatccaaacgcacgattcgggagacacacctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
36059660 |
acatttcatgtctatttgatgaattcttaattcgtgttatctaactagagagtgtgggagtcttacgatatccaaacgcacgactcgggagacacacctt |
36059759 |
T |
 |
| Q |
116 |
atcataatcaattctaaattttttactatagtgttttgtaactaatcttgtcttgcatattttgaatttcccgtgacattcttctttgccttgcacattc |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36059760 |
atcataatcaattctaaatttttgactatagtgttttgtaactaatcttgtcttgcatattttgaatttcccgtgacattcttctttgccttgcacattc |
36059859 |
T |
 |
| Q |
216 |
tcttgacatcagtagtccaatgctcttttagaagaaagattagt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36059860 |
tcttgacatcagtagtccaatgctcttttagaagaaagattagt |
36059903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University