View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12621_low_22 (Length: 238)

Name: NF12621_low_22
Description: NF12621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12621_low_22
NF12621_low_22
[»] chr4 (1 HSPs)
chr4 (171-238)||(10100784-10100851)


Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 171 - 238
Target Start/End: Complemental strand, 10100851 - 10100784
Alignment:
171 aggggaccaacaactgatcttatttatgttataaaacaccacatatataaaagtacatagaagtcttc 238  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10100851 aggggaccaataactgatcttatttatgttataaaacaccacatatataaaagtacatagaagtcttc 10100784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University