View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_high_16 (Length: 355)
Name: NF12622_high_16
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 263 - 338
Target Start/End: Original strand, 47435702 - 47435777
Alignment:
| Q |
263 |
tgaagattcagattttaaccccatgagtttcggacttattccattggggaaaaccctaacgtattcagcttcattt |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47435702 |
tgaagattcagattttaaccccatgagtttcggacttattccattggggaaaaccctaacgtattcagcttcattt |
47435777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University