View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_high_18 (Length: 308)
Name: NF12622_high_18
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 19 - 304
Target Start/End: Complemental strand, 4560219 - 4559934
Alignment:
| Q |
19 |
acatcctatgaatttaacggaataattaagacagaatcattgtcaaccaaacaaattcaaatttcaagaaatccacattcaaaagtatcagttgatttat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4560219 |
acatcctatgaatttaacggaataattaagacagaatcattgtcaaccaaacaaattcaaatttcaagaaatccacattcaaaagtatcagttgatttct |
4560120 |
T |
|
| Q |
119 |
ttgatattgtcaaagattcaatgcatagagaagctaaagggttatatgtgaaaacattaaccaaacaagaaataaagggtcagggttattcattgaacca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4560119 |
ttgatattgtcaaagattcaatgcatagagaagctaaagagttatatgtgaaaacattaaccaaacaagaaataaagggtcatggttattcattgaacca |
4560020 |
T |
|
| Q |
219 |
acacatagactctccaaggcctgttatagtttcgaaggaaccattacatactctttcgaggtcnnnnnnngcacattgggactctc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4560019 |
acacatagactctccaaggcctgttatagtttcgaaggaaccattacatactctttcgaggtcaaaaaaagcacattgggactctc |
4559934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University