View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_high_25 (Length: 266)
Name: NF12622_high_25
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 43873317 - 43873061
Alignment:
| Q |
1 |
catcactatttctaaccgttctacctttatggttcttactccccgattaatatcgagtccttttcaatgcttttgaggaatatgatggcagtaaggggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
43873317 |
catcactatttctaaccgttctacctttatggttcttactccccgattaatatcgagtccttttcaaggcttttgaggaatatgatggcggtaaggggaa |
43873218 |
T |
 |
| Q |
101 |
gtgattataagcttaagactgtctatttttgcttaataattggaagacttagaatagtgtttgggtcctatatgaaacccttactatnnnnnnnnnctgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43873217 |
gtgattataagcttaagactgtctatttttgcttaatgattggaagacttagaatagtgtttgggtcctatatgaaacccttactat-aaaaaaaactgt |
43873119 |
T |
 |
| Q |
201 |
gttttattgattgctggcaatttggtacttagttccaccttcgatccttctctgtgct |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43873118 |
gttttattgattgctggcaatttggtacttagttccaccttcgatccttctttgtgct |
43873061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University