View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_high_29 (Length: 249)
Name: NF12622_high_29
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 239
Target Start/End: Complemental strand, 4559880 - 4559654
Alignment:
| Q |
13 |
aggcgttccttggatagcaagcaaggagccattcgagggattgacggaggaaacaaggctcacaacgtatctaatggctcacaaagaggatatgagagga |
112 |
Q |
| |
|
|||| ||||||||| |||||||||||| |||||||||||||||||| |||||||||||||| |||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
4559880 |
aggctttccttggacagcaagcaaggatccattcgagggattgacgaaggaaacaaggctcgcaacgtgtctaatggctcgcaaagaggatatgagagga |
4559781 |
T |
 |
| Q |
113 |
actcgagcacaatgcttgataaaattgaagaaccagaaacatcgaaaagatcgtcatgtgttgtggctaagttgatgggactagaagctcgcccggactc |
212 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
4559780 |
actcgagcgcaatgcttgataaaattcaagaaccagaaacatcgaaaagatcgtccagtgttgtggttaagttgatgggactagaagctctcccggactc |
4559681 |
T |
 |
| Q |
213 |
gacgcaaactggtcggacttctctctg |
239 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
4559680 |
gacgcaaactggtcggacttctgtctg |
4559654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 200
Target Start/End: Complemental strand, 5025269 - 5025208
Alignment:
| Q |
139 |
gaagaaccagaaacatcgaaaagatcgtcatgtgttgtggctaagttgatgggactagaagc |
200 |
Q |
| |
|
||||||||||||| | |||||| | ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
5025269 |
gaagaaccagaaagtgctaaaagaccatcaagtgttgtggcaaagttgatgggactagaagc |
5025208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University