View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_low_17 (Length: 392)
Name: NF12622_low_17
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 62 - 383
Target Start/End: Complemental strand, 49819294 - 49818980
Alignment:
| Q |
62 |
aattgacttaaaaacatctccacttataaacacatgtacatcggccaaccattatcttctaaagtagaactctcaacaaactcactcgtgcacataattt |
161 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49819294 |
aattgacttaaaaacgtctccacttataaacacat------cggccaaccattatctttcaaagtagaactctcaacaaactcactcgtgcacataattt |
49819201 |
T |
|
| Q |
162 |
attggacatatggagtgacatgagtgtactcgggtggcacaataatggtgatatgatagtggatgatccaacaaattttcgatggactctaaaatcatct |
261 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
49819200 |
attggacatatggagtgacataagtgtactcgagtggcacaataatggtgatatgatagtggatgatccaacaaattttagatggactccaaaatcatct |
49819101 |
T |
|
| Q |
262 |
taaaatttggattgaacctaaccgatgcactacacagtcgacttataagccttgctagtcttatgtaagactcttaaaagctattgatgtcaattggttc |
361 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49819100 |
taaaatttgaattgaacctaacggatgcactacacagtcggcttataagccttgctagttttatgtaagactcttaaaagctattgatgtcaatt-gttc |
49819002 |
T |
|
| Q |
362 |
tagtctttttccacgtcctatg |
383 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
49819001 |
tagtctttttccacgtcatatg |
49818980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University