View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_low_20 (Length: 315)
Name: NF12622_low_20
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 37592419 - 37592200
Alignment:
| Q |
12 |
acagataggaacgaaaatggaaatcaaagaggaaatggaggatggtaagcagaaaggaatgagagaagcattgataggggaacacaacaaccaacttgtc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37592419 |
acagataggaacgaaaatggaaatcaaagaggaaatggaggatggtaagcagaaaggaatgagagaaccattgataggggaacacaacaaccaacttgtc |
37592320 |
T |
 |
| Q |
112 |
catgcaaacaaagatcatcattatccatggatgctttatttcaccacattcattgcagtttgtggttcttatgaatttggtgcttgtgtaagtcttcact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37592319 |
catgcaaacaaagatcatcattatccatggatgctttatttcaccacattcattgcagtttgtggttcttatgaatttggtgcttgtgtaagtcttcact |
37592220 |
T |
 |
| Q |
212 |
tctttctctgtaaatcagca |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37592219 |
tctttctctgtaaatcagca |
37592200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 28 - 231
Target Start/End: Original strand, 37461886 - 37462085
Alignment:
| Q |
28 |
atggaaatcaaagaggaaatggaggatggtaagcagaaaggaatgagagaagcattgataggggaacacaacaaccaacttgtccatgcaaacaaagatc |
127 |
Q |
| |
|
||||| ||||||||||| |||| | ||| || ||||||||||| |||||| |||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37461886 |
atggatatcaaagaggatgtggaaggtggcaaacagaaaggaataagagaaccattgataggtgaacaaaacaaccaacttgtccatgcaaacaaagatc |
37461985 |
T |
 |
| Q |
128 |
atcattatccatggatgctttatttcaccacattcattgcagtttgtggttcttatgaatttggtgcttgtgtaagtcttcacttctttctctgtaaatc |
227 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
37461986 |
atcatcatccatggatggtttacttcaccacattcattgcagtttgtggttcttatgaatttggtgcttgtgtaagtctttacttct----ctgtaaatc |
37462081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University