View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_low_23 (Length: 299)
Name: NF12622_low_23
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 20 - 294
Target Start/End: Original strand, 43672351 - 43672625
Alignment:
| Q |
20 |
taatgctagaccaaaactcgttggtagtttgtgtcctattgagctccactatatgaagccgaaaaacatccaaatggcaagaaatacaagaagagaacat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43672351 |
taatgctagaccaaaactcgttggtagtttgtgtcctattgagctccactatatgaagccgaaaaacacccaaatggcaagaaatacaagaagagaacat |
43672450 |
T |
 |
| Q |
120 |
gaatggagagactaactgaactaagaggggccaaccatgccatgcgaagtcattgtttgagagagacaatctgacatgaggaatgttgtgatcaatagtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672451 |
gaatggagagactaactgaactaagaggggccaaccatgccatgcgaagtcattgtttgagagagacaatctgacatgaggaatgttgtgatcaatagtg |
43672550 |
T |
 |
| Q |
220 |
aaagtacgtgccttttctacttgaactattattcaaatttggcatgtgtgttgactacacaaaacctttgcttct |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43672551 |
aaagtacgtgccttttctacttgaactattattcaaatttggcatgtgtgttgactacacaaaacctttgtttct |
43672625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University