View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_low_27 (Length: 273)
Name: NF12622_low_27
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 6 - 257
Target Start/End: Complemental strand, 33690286 - 33690045
Alignment:
| Q |
6 |
aggagcacagacatttcaggaaaaataacattagcttttttgaggttgtagtcacaaataattcctctacaaagccgaacttccatagacccaaattaag |
105 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33690286 |
aggagcgcaaacatttcaggaaaaataacattagcttttttgaggttgttgtcacaaataattcctctacaaagccgaa---------acccaaattaag |
33690196 |
T |
 |
| Q |
106 |
cgatctatcaacattaactatatatagataccttccataggtcttttttactgtatatggcttctactagttactcgatttatagactcaaaacatgggt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| | || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33690195 |
cgatctatcaacattaactatatatagacaccttcaagagtttctttttactgtatatggcttctactagttactcgatttatagactcaaaacatgggt |
33690096 |
T |
 |
| Q |
206 |
aatatataactcaaattgattatatatgtgatgctactaatcaagcctaaat |
257 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33690095 |
aatatataactc-aattgattagatatgtgatgctactaatcaagcctaaat |
33690045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University