View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_low_29 (Length: 268)
Name: NF12622_low_29
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 4e-47; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 4 - 107
Target Start/End: Complemental strand, 33983973 - 33983870
Alignment:
| Q |
4 |
ccttatatctttttccattcaatgaaggagcaacaaagaccatgtttgacaagtttggaggatcgacaactttttgccaaattttatctatgattgaaga |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33983973 |
ccttgtatctttttccattcaatgaaggagcaacaaagaccatgtttgacaagtttggaggatcgacaactttttgccaaatttgatctatgattgaaga |
33983874 |
T |
|
| Q |
104 |
actc |
107 |
Q |
| |
|
|||| |
|
|
| T |
33983873 |
actc |
33983870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 151 - 231
Target Start/End: Complemental strand, 33983825 - 33983745
Alignment:
| Q |
151 |
gctttttaagagttggagaaccatatagaaggatttactagctttattatcatgtaaaaaaatctatagaatgagaaaatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33983825 |
gctttttaagagttggagaaccatatagaaggatttactagctttattatcatgtaaaaaaatctatagaatgagaaaatt |
33983745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 107
Target Start/End: Complemental strand, 33954224 - 33954149
Alignment:
| Q |
32 |
agcaacaaagaccatgtttgacaagtttggaggatcgacaactttttgccaaattttatctatgattgaagaactc |
107 |
Q |
| |
|
|||||||||||||||| ||||||| ||| ||||||| || ||| ||||| | ||| ||||||||||||||||||| |
|
|
| T |
33954224 |
agcaacaaagaccatgcttgacaaattttgaggatcaactgcttcttgccgactttgatctatgattgaagaactc |
33954149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 175 - 225
Target Start/End: Original strand, 8275232 - 8275284
Alignment:
| Q |
175 |
atagaaggatttactagct--ttattatcatgtaaaaaaatctatagaatgag |
225 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
8275232 |
ataggaggatttactagcaccttattatcatgtaaacaaatctatagaatgag |
8275284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University