View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_low_31 (Length: 266)
Name: NF12622_low_31
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 8983923 - 8983690
Alignment:
| Q |
1 |
agagaaacagcaacgatgataccgaggggaagaggaccacgccggcgaggatggcatcgtcgaaaacagcaactttgatgacggcaaagacaatgataat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8983923 |
agagaaacagcaacgatgataccgaggggaagaggactacaccggcgaggatggcatcgtcggaaacagcaactttgatgacggcaaagacaatgataat |
8983824 |
T |
|
| Q |
101 |
gacgataacatttgctatgccagaaacgacaacgatgaccgcaaagaaatagacatttttgaaattcaaaattagaattttatttgtgtttgtgtactta |
200 |
Q |
| |
|
||||| |||||||| ||||| |||||| |||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
8983823 |
gacgacaacatttgttatgctggaaacggcaacgatgacggcaaaaaaatagacatttttgaaattcataattagaattttatttgtgtttgtgtacgta |
8983724 |
T |
|
| Q |
201 |
gtacaaggaaatagacattacatattaaatttgc |
234 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| |
|
|
| T |
8983723 |
gtacgaggaaatagacattgcatattaaatttgc |
8983690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University