View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_low_40 (Length: 211)
Name: NF12622_low_40
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 14 - 162
Target Start/End: Original strand, 34318515 - 34318663
Alignment:
| Q |
14 |
ttcactgtgtagggagcaagaaaatctaaggatattacaagttgnnnnnnntaaatagttctaggttgaagtggaagttttataattgtgacgtatgagg |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34318515 |
ttcactatgtagggagcaagaaaatctaaggatattacaagttgaaaaaaataaatagttctaggttgaagtggaagttttataattgtgacgtatgagg |
34318614 |
T |
|
| Q |
114 |
taacgtatactttgtagatatcattgagtatttgaatgtgatcctctcc |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34318615 |
taacgtatactttgtagatatcattgagtatttgaatgtgatcctctcc |
34318663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University