View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12622_low_43 (Length: 206)
Name: NF12622_low_43
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12622_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 196
Target Start/End: Complemental strand, 37590602 - 37590428
Alignment:
| Q |
22 |
tgatacaaaccaagagcctctccttcgtcaaccgagcacattagagcgaaccacattgttttagcaagtacaaattgcccttcatcatcacgggtacacc |
121 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37590602 |
tgatacaaaccaagagcatctccttcgtcaactgagcacattagagcgaaccacattgttttagcaagtacaaattgcccttcatcatcacgggtacacc |
37590503 |
T |
 |
| Q |
122 |
caataccaaaccgattcctagaagccgaaaatgaggcatctactttacacttcattcttctgcgcctatgcttct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||| |
|
|
| T |
37590502 |
caataccaaaccgattcctagaagccgaaaatgaggcatctacattacacttcattcttctgcgccgaggcttct |
37590428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University