View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12623_high_15 (Length: 227)
Name: NF12623_high_15
Description: NF12623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12623_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 33 - 209
Target Start/End: Complemental strand, 47505168 - 47504999
Alignment:
| Q |
33 |
gtatttggtgtatcgtcaccggaaaataaataacggaaagtagttgtatcgttgtcgaaaaatacctaataagtagagaaaagttgacgttcgcatagat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47505168 |
gtatttggtgtatcgtcaccggaaaataaataacagaaagtagttgtatcgttgtcgaaaaatacctaataagtagaga--------cgttcgcatagat |
47505077 |
T |
 |
| Q |
133 |
gggcatctcgatctaaatctcaacattcaaaa-acaccaacataattaacactttaataggataggatggtcataatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47505076 |
gggcatctcgatctaaatctcaacattcaaaacactccaacataattaacactttaataggataggatggtcataatt |
47504999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University