View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12624_high_11 (Length: 305)
Name: NF12624_high_11
Description: NF12624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12624_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 287
Target Start/End: Complemental strand, 47820714 - 47820443
Alignment:
| Q |
16 |
agggaaccagaaaaacactagctgcccaaaccaaaaaacagaagcaaaatggtaaaggctactgaaccaaaaagttcggctaccccactggccagtcgct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47820714 |
agggaaccagaaaaacactagctgcccaaaccaaaaaacagaagcaaaatggtaaaggctactgaaccaaaaagttcggctaccccactggccagtcgct |
47820615 |
T |
 |
| Q |
116 |
gcaaaacaaaaacagcagcaacaggaggcacaaaaagccgnnnnnnnngacagcacacccaaacagccaaaccgcccaaggctccctaataaaccagcac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47820614 |
gcaaaacaaaaacagcagcaacaggaggcacaaaaagacgaaaaaacagacagcacacccaaacagccaaaccgcccaaagctccctaataaaccagcac |
47820515 |
T |
 |
| Q |
216 |
ctcttctaggaaccaccagcaaggcaaaaaacaaccgcagcttctaaaacaacctgttaacagacccaaacc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
47820514 |
ctcttctaggaaccaccagcaaggcaaaaaacaaccgcaacttctaaaacaaccttttaacagacccaaacc |
47820443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University