View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12624_high_13 (Length: 291)
Name: NF12624_high_13
Description: NF12624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12624_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 3487268 - 3487075
Alignment:
| Q |
13 |
aagaacaccgtgcattgtggaggtgggagaagaaggatgatgatctccttcgaaattagcgtcgacttcgaagtatttagaagcggtgtttttgacaaga |
112 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3487268 |
aagaacaccgggcattggggaggtgggagaagaaggatgatgatctccttcgaaattagcgtcgacttcgaagtatttagaagcggtgtttttgacaaga |
3487169 |
T |
|
| Q |
113 |
gtgtgtaatccaatagcgattacaagagcggtgaatatgaattgaaggaatcgattgagatcccacgatacaccagcgattacaagcatctacg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3487168 |
gtgtgtaatccaatagcgattacaagagcggtgaatatgaattgaaggaatcgattgagatcccacgatacaccagcgattacaagcatctacg |
3487075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University