View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12624_high_22 (Length: 224)
Name: NF12624_high_22
Description: NF12624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12624_high_22 |
 |  |
|
| [»] scaffold0286 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 5e-52; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 45 - 176
Target Start/End: Original strand, 2153465 - 2153596
Alignment:
| Q |
45 |
aaatgttactagagagaatgtggaatcaattttaactctagattcttgcttttgggcatatgttgaagaggctcttatttcatgcaagaaattggttgaa |
144 |
Q |
| |
|
||||||||||| ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
2153465 |
aaatgttactaaagataaagtggaatcaattttaactctagattcttgcttttgggcatatgttgaagaggctcttatttcatgcaaaaaattggatgaa |
2153564 |
T |
 |
| Q |
145 |
aaatctagtgacattgaaaaggatgaggcaac |
176 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |
|
|
| T |
2153565 |
aaacttagtgacattgaaaaggatgaggcaac |
2153596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 59 - 117
Target Start/End: Original strand, 2168722 - 2168780
Alignment:
| Q |
59 |
agaatgtggaatcaattttaactctagattcttgcttttgggcatatgttgaagaggct |
117 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
2168722 |
agaatgtggaagtgattttgactatagattcttgcttttgggcacatgttgaagaggct |
2168780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 59 - 117
Target Start/End: Original strand, 2180355 - 2180413
Alignment:
| Q |
59 |
agaatgtggaatcaattttaactctagattcttgcttttgggcatatgttgaagaggct |
117 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
2180355 |
agaatgtggaagtgattttgactatagattcttgcttttgggcacatgttgaagaggct |
2180413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 117
Target Start/End: Original strand, 2162573 - 2162617
Alignment:
| Q |
73 |
attttaactctagattcttgcttttgggcatatgttgaagaggct |
117 |
Q |
| |
|
||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
2162573 |
attttgactatagattcttgcttttgggcacatgttgaagaggct |
2162617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 117
Target Start/End: Original strand, 2207604 - 2207637
Alignment:
| Q |
84 |
agattcttgcttttgggcatatgttgaagaggct |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
2207604 |
agattcttgcttttgggcacatgttgaagaggct |
2207637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 53 - 129
Target Start/End: Complemental strand, 27784970 - 27784894
Alignment:
| Q |
53 |
ctagagagaatgtggaatcaattttaactctagattcttgcttttgggcatatgttgaagaggctcttatttcatgc |
129 |
Q |
| |
|
||||| ||||||||||| | ||||| ||| ||||||||||||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
27784970 |
ctagaaagaatgtggaagctattttgactatagattcttgcttttgggcgcatgttgaagaggctcttcttttatgc |
27784894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0286 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0286
Description:
Target: scaffold0286; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 117
Target Start/End: Complemental strand, 14531 - 14487
Alignment:
| Q |
73 |
attttaactctagattcttgcttttgggcatatgttgaagaggct |
117 |
Q |
| |
|
||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
14531 |
attttgactatagattcttgcttttgggcacatgttgaagaggct |
14487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University