View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12624_low_17 (Length: 276)
Name: NF12624_low_17
Description: NF12624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12624_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 23 - 266
Target Start/End: Complemental strand, 371448 - 371205
Alignment:
| Q |
23 |
aggtagaaagcaaacaagtaaataattacgaagctatcaacaatagaagaaattttttgtagaaaggaatttaagtggagaagagagctttttgggcgga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
371448 |
aggtagaaagcaaacaagtaaataattaggaagctatcaacaatagaagaaattttttgtagaaaggaatttaagtggagaagagagctttttgggcgga |
371349 |
T |
 |
| Q |
123 |
gatagattagtgtggggagaggacccgtcgaattgccattcctttaaatgagcttataaagtcttaatggaagacaacaatttgggggagcagcatcctg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
371348 |
gatagattagtgtggggagaggacccgtcgaattgccattcctttaaatgagcttataaaatcttaatggaagacaacaatttaggggagcagcatcctg |
371249 |
T |
 |
| Q |
223 |
ttaaaaatctgtgacataattcgatttcgttaaaagtgtctgtg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
371248 |
ttaaaaatctgtgacataattcgatttcgttaaaagtgtctgtg |
371205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University